HIV resistant Indo-Europeans

[Token]

https://4.bp.blogspot.com/-5-rvA6IqHuE/Xb5t7hGmiTI/AAAAAAAAITs/KTUkvHFZJRUOZSDqn9y687kjQHuPcipAgCLcBGAsYHQ/s1600/Ancient_samples.jpg

https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg

[Token]

Not HIV resistant = not Aryan.

[War Chef]

Can I find this gene on 23andme?

[Annihilus]

you need 2 copies to be resistant so the percentages are a bit misleading as they show a single copy


Can I find this gene on 23andme?

yes

[Benyzero]

Promethease shows that I have that resistant gene actually : )

[Token]

Promethease shows that I have that resistant gene actually : )

Homozygote?

[Benyzero]

https://i.imgur.com/1SQxFg1.png

https://i.imgur.com/IQRwW8f.png

[Benyzero]

I think it's pretty cool

https://i.imgur.com/uOHI9Qq.png

[Nurzat]

on 23andme this is SNP i3003626 under gene CCR5 at position 46414947

I don't think I have this mutation on the gene, since my result is:

GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA


to have the mutation you have to lack all these 32 nucleotides from this gene, right? (would display it " -/- " I think)

[Benyzero]

Bad call Im also not resistant, just have some genes that slows the progress of it... Nvm, wear condom, don't bang sluts . lol

[Samnium]

Would be good to the different regional frequencies, I bet that N.Italians have percentages similar to France and Sicilians more similar to Greece

[Token]

Bad call Im also not resistant, just have some genes that slows the progress of it... Nvm, wear condom, don't bang sluts . lol

Non Indo-European problems.

[Benyzero]

Non Indo-European problems.

yup

[Hulu]

Bad call Im also not resistant, just have some genes that slows the progress of it... Nvm, wear condom, don't bang sluts . lol

which gene is it?

[Benyzero]

which gene is it?

Dunno man text 'Hiv ' in your promethease report searcher

[Hulu]

Dunno man text 'Hiv ' in your promethease report searcher

I don't have that. I thought we could check 23andme

[TheOldNorth]

Not HIV resistant = not Aryan.

In that case are 85% of Europeans non aryan?

[Token]

In that case are 85% of Europeans non aryan?

Yes.

[Annihilus]

In that case are 85% of Europeans non aryan?

Europe population with 2 alles (resistant against hiv) sits at around 1%.

It's a very interesting mutation, probably due to smallpox epidemics.

It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.

https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg

[TheOldNorth]

Europe population with 2 alles (resistant against hiv) sits at around 1%.

It's a very interesting mutation, probably due to smallpox epidemics.

It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.

https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg

Well that’s interesting because I heard somewhere that about a fifth of the European population is resistant to HIV... could this be from a different mutation

[Pine]

Europe population with 2 alles (resistant against hiv) sits at around 1%.

It's a very interesting mutation, probably due to smallpox epidemics.

It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.

https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg

This is one hell of a breakthrough. You managed to prove that Jews are Frenchmen.

[Annihilus]

This is one hell of a breakthrough. You managed to prove that Jews are Frenchmen.

The map clearly shows Jews are European colonists

[TheOldNorth]

Europe population with 2 alles (resistant against hiv) sits at around 1%.

It's a very interesting mutation, probably due to smallpox epidemics.

It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.

https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg

Oh I also just noticed you’re anti-Israel, you know despite the fact genetic testing has proven that they have at least some ancient Levantine ancestry and the fact they whooped Muslim ass like the poles at the battle of Vienna

[Annihilus]

Oh I also just noticed you’re anti-Israel, you know despite the fact genetic testing has proven that they have at least some ancient Levantine ancestry and the fact they whooped Muslim ass like the poles at the battle of Vienna

I am just stating a fact. I don't buy the we left and came back story

[Pine]

I am just stating a fact. I don't buy the we left and came back story

Mon amie, please provide me the website where you got that pic.

[Token]

Earliest HIV resistant individual sampled belongs to Khvalynsk culture, the PIE homeland.

http://s155239215.onlinehome.us/turkic/btn_GeographyMaps/BC3000MiddleVolga-Yaik.gif

[Joso]

Why are indo-Europeans so superior genetically? ( not nazi, i swear)

[Token]

Why are indo-Europeans so superior genetically? ( not nazi, i swear)

They are Dyeus chosen people.

[Pine]

I am just stating a fact. I don't buy the we left and came back story

I want to hear your theory where Jews come from then.

[Coastal Elite]

Thor had this resistance plus Celiac Disease

[Token]

Thor had this resistance plus Celiac Disease

And Cystic Fibrosis.
https://bellbeakerblogger.blogspot.com/2018/09/beakerfolk-and-cystic-fibrosis-farrell.html

[ntsyd]

Europe population with 2 alles (resistant against hiv) sits at around 1%.

It's a very interesting mutation, probably due to smallpox epidemics.

It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.

https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg

Yes, the frequency of this one gene is the definitive evidence, not the multitude of genetic studies showing clear Levantine and East Mediterranean genetic origin for the vast majority of modern Jews... :rolleyes:

[Pine]

Yes, the frequency of this one gene is the definitive evidence, not the multitude of genetic studies showing clear Levantine and East Mediterranean genetic origin for the vast majority of modern Jews... :rolleyes:

Never mind other medical genetics pointing away from Europe (i.e Lactose intolerance rates). I say this proves Jews are the Chosen people.

[PaleoEuropean]

CCR5 has literally nothing to do with Indo-Aryans and everything to do with the black plague, small pox and other diseases. It also is said to originate in Northern Europe not in the Indo-Aryan strongholds.

[Token]

CCR5 has literally nothing to do with Indo-Aryans and everything to do with the black plague, small pox and other diseases. It also is said to originate in Northern Europe not in the Indo-Aryan strongholds.

The plague was spread by Indo-European. Lack of immune resistance against it is what killed farmer and hunter cucks.

https://www.nature.com/articles/s41467-018-04550-9
Our results contribute to investigations regarding the evolution of Y. pestis and its disease potential in past human populations. We used shotgun sequencing and in-solution capture to reconstruct Y. pestis genomes from Bronze Age individuals (RT5 and RT6) in the Samara region. In addition, we retrieved a 4.2-fold human genome from individual RT5 through shotgun sequencing. Population genetic analysis identified individual RT5 as having close genetic affinity to EBA European populations and MLBA populations from the Eurasian steppe region.

[PaleoEuropean]

The plague was spread by Indo-European. Lack of immune resistance against it is what killed farmer and hunter cucks.

https://www.nature.com/articles/s41467-018-04550-9
Our results contribute to investigations regarding the evolution of Y. pestis and its disease potential in past human populations. We used shotgun sequencing and in-solution capture to reconstruct Y. pestis genomes from Bronze Age individuals (RT5 and RT6) in the Samara region. In addition, we retrieved a 4.2-fold human genome from individual RT5 through shotgun sequencing. Population genetic analysis identified individual RT5 as having close genetic affinity to EBA European populations and MLBA populations from the Eurasian steppe region.

Your agenda to make up for your insecurities has been exposed xD, what a loser.

[Token]

Your agenda to make up for your insecurities has been exposed xD, what a loser.

I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.

[PaleoEuropean]

I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.

coolstorybro.gif

[Coastal Elite]

According to 23andMe, I have i3003626(D;I) - Not HIV resistant, but possibly slower progression to AIDS if infected. Apparently there are two magnitudes, 2 (slower progression) and 5 (HIV resistant)

https://i.imgur.com/wGoCQao.jpg

[TheOldNorth]

I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.

cities dull the mind into a simple day-to-day cycle of work and pay, the wild stimulates the mind, especially on the cold north European plain, and in the mountains of the north, the cities only advantage is allow smart but socially inept people to make innovations that makes them and others like them single-handedly support societies progress, on the other hand in a tribe in the north of europe before the bronze age, every man had to have a wit about him or die to nature's challenges

[TheOldNorth]

The plague was spread by Indo-European. Lack of immune resistance against it is what killed farmer and hunter cucks.

https://www.nature.com/articles/s41467-018-04550-9
Our results contribute to investigations regarding the evolution of Y. pestis and its disease potential in past human populations. We used shotgun sequencing and in-solution capture to reconstruct Y. pestis genomes from Bronze Age individuals (RT5 and RT6) in the Samara region. In addition, we retrieved a 4.2-fold human genome from individual RT5 through shotgun sequencing. Population genetic analysis identified individual RT5 as having close genetic affinity to EBA European populations and MLBA populations from the Eurasian steppe region.

the black plague was spread by mongols and mostly EEF italian merchants fleeing crimea, wth are you talking about

[TheOldNorth]

I am just stating a fact. I don't buy the we left and came back story

who said they didn't pick up some genetic baggage on the way? the genetics say a bunch of jewish men and far fewer jewish women came to italy during the roman empire days, picked up some roman brides, and when rome fell, mostly fled to the rhine and then eastern europe, and they picked up 40% of their DNA in italy, and less then 5% on average from the rhine and beyond until recent times

[TheOldNorth]

I want to hear your theory where Jews come from then.

she probably thinks they're Khazars like some Zionist plot conspiracy theorist

[TheOldNorth]

Yes.

you know I love how you go on about aryan supremacy and then talk about how city dwelling farmers are superior to the aryans

[dududud]

My mother :
rs9264942(C;C)
90% reduction in HIV viral load The rs9264942(C;C) genotype is reported to be associated with a 90% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV.
This SNP (C/T) is in 5' region of the HLA-C gene, 35 kb away from transcription initiation in or around the HLA-C gene. "People with this tiny sequence variation, dubbed rs9264942, appear to have up to 90% less virus in their systems than those who carry other polymorphisms. About 10% of Europeans appear to carry two copies of rs9264942, which leads to an average 90% viral load reduction. About 50% of Europeans carry one copy, which gives a 60% reduction. By comparison, less than 40% of people of African descent appear to carry a single copy of the polymorphism." Genetic variation may lower HIV load by 90% They are referring to the (C;C) genotype giving a 90% reduction and the (C;T) giving a 60% reduction. dbSNP page This SNP is also reported to account for 6.5% of the 15% variation in viral load set point in asymptomatic...
more info

I'm, like my cousin (same sardinian grandfather, except mine is on maternal side), C/T (rs9264942(C;T)
60% reduction in HIV viral load The rs9264942(C;T) genotype is reported to be associated with a 60% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV)

[Peterski]

The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.

Why do you doubt?: https://en.wikipedia.org/wiki/Normans#On_crusade


https://www.youtube.com/watch?v=X7a9-OOV_Qw


https://www.youtube.com/watch?v=GwMImWeS_Uc


https://www.youtube.com/watch?v=41Dot2JWjmw


https://www.youtube.com/watch?v=lcjMnfPWxIg

[Jana]

the black plague was spread by mongols and mostly EEF italian merchants fleeing crimea, wth are you talking about

Lol. He is talking about bronze age, not about medieval black death. It indeed did spread with Indo-Europeans from steppes.

[dududud]

Lol. He is talking about bronze age, not about medieval black death. It indeed did spread with Indo-Europeans from steppes.

Do you think the C;C of my mother come from her mother, so?

[Enr1989]

My mother :
rs9264942(C;C)
90% reduction in HIV viral load The rs9264942(C;C) genotype is reported to be associated with a 90% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV.
This SNP (C/T) is in 5' region of the HLA-C gene, 35 kb away from transcription initiation in or around the HLA-C gene. "People with this tiny sequence variation, dubbed rs9264942, appear to have up to 90% less virus in their systems than those who carry other polymorphisms. About 10% of Europeans appear to carry two copies of rs9264942, which leads to an average 90% viral load reduction. About 50% of Europeans carry one copy, which gives a 60% reduction. By comparison, less than 40% of people of African descent appear to carry a single copy of the polymorphism." Genetic variation may lower HIV load by 90% They are referring to the (C;C) genotype giving a 90% reduction and the (C;T) giving a 60% reduction. dbSNP page This SNP is also reported to account for 6.5% of the 15% variation in viral load set point in asymptomatic...
more info

I'm, like my cousin (same sardinian grandfather, except mine is on maternal side), C/T (rs9264942(C;T)
60% reduction in HIV viral load The rs9264942(C;T) genotype is reported to be associated with a 60% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV)

I have the same combination

[dududud]

I have the same combination

Interesting...

[Jana]

Do you think the C;C of my mother come from her mother, so?

Sorry, I really have no clue about these things. :(

[dududud]

Sorry, I really have no clue about these things. :(

Don't worry. Pas de problème, Madame !

[Enr1989]

Do you think the C;C of my mother come from her mother, so?

you get one from each parent, also your mother did

[dududud]

you get one from each parent, also your mother did

So her father is maybe C;T and her mother C;C or vice versa ?

[Adamm]

My mother :
rs9264942(C;C)
90% reduction in HIV viral load The rs9264942(C;C) genotype is reported to be associated with a 90% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV.
This SNP (C/T) is in 5' region of the HLA-C gene, 35 kb away from transcription initiation in or around the HLA-C gene. "People with this tiny sequence variation, dubbed rs9264942, appear to have up to 90% less virus in their systems than those who carry other polymorphisms. About 10% of Europeans appear to carry two copies of rs9264942, which leads to an average 90% viral load reduction. About 50% of Europeans carry one copy, which gives a 60% reduction. By comparison, less than 40% of people of African descent appear to carry a single copy of the polymorphism." Genetic variation may lower HIV load by 90% They are referring to the (C;C) genotype giving a 90% reduction and the (C;T) giving a 60% reduction. dbSNP page This SNP is also reported to account for 6.5% of the 15% variation in viral load set point in asymptomatic...
more info

I'm, like my cousin (same sardinian grandfather, except mine is on maternal side), C/T (rs9264942(C;T)
60% reduction in HIV viral load The rs9264942(C;T) genotype is reported to be associated with a 60% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV)

I got the same as you, it's probably normal for all people to have that.

[Enr1989]

So her father is maybe C;T and her mother C;C or vice versa ?
Yes, they had at least a c each

[TheOldNorth]

Lol. He is talking about bronze age, not about medieval black death. It indeed did spread with Indo-Europeans from steppes.

oh, to be honest I forgot there was a bronze age black death

[Imperator Biff]

David Reich published a study on the CCR5 allele related to HIV progression back in the 90s I think.
Swedes are the most homozygous.

[Annihilus]

who said they didn't pick up some genetic baggage on the way? the genetics say a bunch of jewish men and far fewer jewish women came to italy during the roman empire days, picked up some roman brides, and when rome fell, mostly fled to the rhine and then eastern europe, and they picked up 40% of their DNA in italy, and less then 5% on average from the rhine and beyond until recent times

Yes, mixed to a point they became European. Look Judaism is just a religion and they had a time they expanded mostly by conversions. How else can you have fully black or Chinese Jews?

[Pine]

Yes, mixed to a point they became European. Look Judaism is just a religion and they had a time they expanded mostly by conversions. How else can you have fully black or Chinese Jews?

What % European do you think they are and what kinda European?

[L3mon J3lly]

Yes, mixed to a point they became European. Look Judaism is just a religion and they had a time they expanded mostly by conversions. How else can you have fully black or Chinese Jews?

Nonsense. Jews were already mixed with Europeans such as Scythians, from whom they got a lot of R1a and Q1b haplogroups from when they invaded the middle east. Studies just don't call it "European" because it will hurt their bitchboy feelings if they have to admit anyone anywhere got European DNA from their paternal side. AngloJew has done a lot of writing on this subject.

[Harkonnen]

And how the hell are Indo-Europeans once again pulled into this? As far as I know this mutation was thought to rise in middle ages during plague.

[Harkonnen]

CCR5 has literally nothing to do with Indo-Aryans and everything to do with the black plague, small pox and other diseases. It also is said to originate in Northern Europe not in the Indo-Aryan strongholds.

This is exactly what I thought, and even the spread seems point to something like that. I don't know if they have found something new.

[Harkonnen]

Not HIV resistant = not Aryan.

I literally have double skull breadth to the Aryans. So I'm deffo not Aryan.

[Harkonnen]

There is a saying that Jews put their nose in every matter. But I think the real Jews are the Indo-Europeans. HAVE SOME RESPECT YOU FUCKING NIGGERS

[Harkonnen]

Well in any case those higher than average percentages are clearly the result of recent bottlenecks, so they are not indicative of real Indo-European ancestry.

[Harkonnen]

I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.

Wuuuut what is this Jewtalk? Oh I forgot, I'm talking to a Indo-European.

[PaleoEuropean]

This is exactly what I thought, and even the spread seems point to something like that. I don't know if they have found something new.

I think the highest concentration of the mutation is in Finland/Sweden could have developed when the Asiatic peoples mixed with Hunter Gatherers and Neolithic Farmers, could have even been carried by the Neolithic Farmers, there are an immense number of possibilities.

[Dick]

I think the highest concentration of the mutation is in Finland/Sweden could have developed when the Asiatic peoples mixed with Hunter Gatherers and Neolithic Farmers, could have even been carried by the Neolithic Farmers, there are an immense number of possibilities.

The Saami

[Lemon Kush]

16.5% is the highest? I still wouldn't take that gamble

[Voskos]

Israel= aryan.

[Sp_loa]

My grandmother is a carries (Heterozygous) and has other snps against HIV. I have no idea about my self (when I take 23andme I’ll know).

When it comes to medical genetics I have the win-win situation. I have snps that are associated with autoimmunity in the European population (increased risk for Celiac and other disorders and Indeed I have celiac and so many autoimmune disorders that my immunologist said I just have a condition called Immune-Dysregulation).

But I am also lactose intolerant (and the only one in my family), probably from the non European roots.

Fun (:

[Kamal900]

Um..brah. Only Indo-Iranians are the real Aryans, not Europeans. My Persian friend, Babak, is a fine example of an Aryan.
https://pbs.twimg.com/profile_images/915543535163645952/ZEC4WGoH_400x400.jpg

[Token]

Um..brah. Only Indo-Iranians are the real Aryans, not Europeans. My Persian friend, Babak, is a fine example of an Aryan.
I remember Babak denying with all his might the European roots of Proto-Indo-Iranic people. Now he at least accept the undeniable truth, that Indo-Iranians were originally North Europeans living in the Central Asian steppes.

[Babak]

I remember Babak denying with all his might the European roots of Proto-Indo-Iranic people. Now he at least accept the undeniable truth, that Indo-Iranians were originally North Europeans living in the Central Asian steppes.

North european-like* There's a difference bud.

[Babak]

Um..brah. Only Indo-Iranians are the real Aryans, not Europeans. My Persian friend, Babak, is a fine example of an Aryan.
https://pbs.twimg.com/profile_images/915543535163645952/ZEC4WGoH_400x400.jpg

Lol yep. Europeans have nothing to do with Aryans.