View Full Version : HIV resistant Indo-Europeans
Token
11-03-2019, 02:04 PM
https://4.bp.blogspot.com/-5-rvA6IqHuE/Xb5t7hGmiTI/AAAAAAAAITs/KTUkvHFZJRUOZSDqn9y687kjQHuPcipAgCLcBGAsYHQ/s1600/Ancient_samples.jpg
https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg
Token
11-03-2019, 02:07 PM
Not HIV resistant = not Aryan.
War Chef
11-03-2019, 02:09 PM
Can I find this gene on 23andme?
Annihilus
11-03-2019, 02:10 PM
you need 2 copies to be resistant so the percentages are a bit misleading as they show a single copy
Can I find this gene on 23andme?
yes
Benyzero
11-03-2019, 02:18 PM
Promethease shows that I have that resistant gene actually : )
Token
11-03-2019, 02:19 PM
Promethease shows that I have that resistant gene actually : )
Homozygote?
Benyzero
11-03-2019, 02:28 PM
https://i.imgur.com/1SQxFg1.png
https://i.imgur.com/IQRwW8f.png
Benyzero
11-03-2019, 02:30 PM
I think it's pretty cool
https://i.imgur.com/uOHI9Qq.png
Nurzat
11-03-2019, 02:47 PM
on 23andme this is SNP i3003626 under gene CCR5 at position 46414947
I don't think I have this mutation on the gene, since my result is:
GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA
to have the mutation you have to lack all these 32 nucleotides from this gene, right? (would display it " -/- " I think)
Benyzero
11-03-2019, 03:01 PM
Bad call Im also not resistant, just have some genes that slows the progress of it... Nvm, wear condom, don't bang sluts . lol
Samnium
11-03-2019, 03:05 PM
Would be good to the different regional frequencies, I bet that N.Italians have percentages similar to France and Sicilians more similar to Greece
Token
11-03-2019, 03:10 PM
Bad call Im also not resistant, just have some genes that slows the progress of it... Nvm, wear condom, don't bang sluts . lol
Non Indo-European problems.
Benyzero
11-03-2019, 03:27 PM
Non Indo-European problems.
yup
Bad call Im also not resistant, just have some genes that slows the progress of it... Nvm, wear condom, don't bang sluts . lol
which gene is it?
Benyzero
11-03-2019, 06:16 PM
which gene is it?
Dunno man text 'Hiv ' in your promethease report searcher
Dunno man text 'Hiv ' in your promethease report searcher
I don't have that. I thought we could check 23andme
TheOldNorth
11-03-2019, 07:09 PM
Not HIV resistant = not Aryan.
In that case are 85% of Europeans non aryan?
Token
11-03-2019, 07:21 PM
In that case are 85% of Europeans non aryan?
Yes.
Annihilus
11-03-2019, 07:41 PM
In that case are 85% of Europeans non aryan?
Europe population with 2 alles (resistant against hiv) sits at around 1%.
It's a very interesting mutation, probably due to smallpox epidemics.
It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.
https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg
TheOldNorth
11-03-2019, 08:01 PM
Europe population with 2 alles (resistant against hiv) sits at around 1%.
It's a very interesting mutation, probably due to smallpox epidemics.
It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.
https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg
Well that’s interesting because I heard somewhere that about a fifth of the European population is resistant to HIV... could this be from a different mutation
Europe population with 2 alles (resistant against hiv) sits at around 1%.
It's a very interesting mutation, probably due to smallpox epidemics.
It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.
https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg
This is one hell of a breakthrough. You managed to prove that Jews are Frenchmen.
Annihilus
11-03-2019, 08:21 PM
This is one hell of a breakthrough. You managed to prove that Jews are Frenchmen.
The map clearly shows Jews are European colonists
TheOldNorth
11-03-2019, 08:21 PM
Europe population with 2 alles (resistant against hiv) sits at around 1%.
It's a very interesting mutation, probably due to smallpox epidemics.
It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.
https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg
Oh I also just noticed you’re anti-Israel, you know despite the fact genetic testing has proven that they have at least some ancient Levantine ancestry and the fact they whooped Muslim ass like the poles at the battle of Vienna
Annihilus
11-03-2019, 08:23 PM
Oh I also just noticed you’re anti-Israel, you know despite the fact genetic testing has proven that they have at least some ancient Levantine ancestry and the fact they whooped Muslim ass like the poles at the battle of Vienna
I am just stating a fact. I don't buy the we left and came back story
I am just stating a fact. I don't buy the we left and came back story
Mon amie, please provide me the website where you got that pic.
Token
11-03-2019, 08:34 PM
Earliest HIV resistant individual sampled belongs to Khvalynsk culture, the PIE homeland.
http://s155239215.onlinehome.us/turkic/btn_GeographyMaps/BC3000MiddleVolga-Yaik.gif
Why are indo-Europeans so superior genetically? ( not nazi, i swear)
Token
11-03-2019, 08:42 PM
Why are indo-Europeans so superior genetically? ( not nazi, i swear)
They are Dyeus chosen people.
I am just stating a fact. I don't buy the we left and came back story
I want to hear your theory where Jews come from then.
Coastal Elite
11-03-2019, 09:01 PM
Thor had this resistance plus Celiac Disease
Token
11-03-2019, 09:16 PM
Thor had this resistance plus Celiac Disease
And Cystic Fibrosis.
https://bellbeakerblogger.blogspot.com/2018/09/beakerfolk-and-cystic-fibrosis-farrell.html
ntsyd
11-03-2019, 09:21 PM
Europe population with 2 alles (resistant against hiv) sits at around 1%.
It's a very interesting mutation, probably due to smallpox epidemics.
It's a very young mutation and might have been spread by Vikings. The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.
https://ars.els-cdn.com/content/image/1-s2.0-S0198885917305104-gr1.jpg
Yes, the frequency of this one gene is the definitive evidence, not the multitude of genetic studies showing clear Levantine and East Mediterranean genetic origin for the vast majority of modern Jews... :rolleyes:
Yes, the frequency of this one gene is the definitive evidence, not the multitude of genetic studies showing clear Levantine and East Mediterranean genetic origin for the vast majority of modern Jews... :rolleyes:
Never mind other medical genetics pointing away from Europe (i.e Lactose intolerance rates). I say this proves Jews are the Chosen people.
PaleoEuropean
11-03-2019, 09:35 PM
CCR5 has literally nothing to do with Indo-Aryans and everything to do with the black plague, small pox and other diseases. It also is said to originate in Northern Europe not in the Indo-Aryan strongholds.
Token
11-03-2019, 09:49 PM
CCR5 has literally nothing to do with Indo-Aryans and everything to do with the black plague, small pox and other diseases. It also is said to originate in Northern Europe not in the Indo-Aryan strongholds.
The plague was spread by Indo-European. Lack of immune resistance against it is what killed farmer and hunter cucks.
https://www.nature.com/articles/s41467-018-04550-9
Our results contribute to investigations regarding the evolution of Y. pestis and its disease potential in past human populations. We used shotgun sequencing and in-solution capture to reconstruct Y. pestis genomes from Bronze Age individuals (RT5 and RT6) in the Samara region. In addition, we retrieved a 4.2-fold human genome from individual RT5 through shotgun sequencing. Population genetic analysis identified individual RT5 as having close genetic affinity to EBA European populations and MLBA populations from the Eurasian steppe region.
PaleoEuropean
11-03-2019, 10:01 PM
The plague was spread by Indo-European. Lack of immune resistance against it is what killed farmer and hunter cucks.
https://www.nature.com/articles/s41467-018-04550-9
Our results contribute to investigations regarding the evolution of Y. pestis and its disease potential in past human populations. We used shotgun sequencing and in-solution capture to reconstruct Y. pestis genomes from Bronze Age individuals (RT5 and RT6) in the Samara region. In addition, we retrieved a 4.2-fold human genome from individual RT5 through shotgun sequencing. Population genetic analysis identified individual RT5 as having close genetic affinity to EBA European populations and MLBA populations from the Eurasian steppe region.
Your agenda to make up for your insecurities has been exposed xD, what a loser.
Token
11-03-2019, 10:19 PM
Your agenda to make up for your insecurities has been exposed xD, what a loser.
I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.
PaleoEuropean
11-03-2019, 11:14 PM
I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.
coolstorybro.gif
Coastal Elite
11-03-2019, 11:41 PM
According to 23andMe, I have i3003626(D;I) - Not HIV resistant, but possibly slower progression to AIDS if infected. Apparently there are two magnitudes, 2 (slower progression) and 5 (HIV resistant)
https://i.imgur.com/wGoCQao.jpg
TheOldNorth
11-04-2019, 03:01 AM
I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.
cities dull the mind into a simple day-to-day cycle of work and pay, the wild stimulates the mind, especially on the cold north European plain, and in the mountains of the north, the cities only advantage is allow smart but socially inept people to make innovations that makes them and others like them single-handedly support societies progress, on the other hand in a tribe in the north of europe before the bronze age, every man had to have a wit about him or die to nature's challenges
TheOldNorth
11-04-2019, 03:02 AM
The plague was spread by Indo-European. Lack of immune resistance against it is what killed farmer and hunter cucks.
https://www.nature.com/articles/s41467-018-04550-9
Our results contribute to investigations regarding the evolution of Y. pestis and its disease potential in past human populations. We used shotgun sequencing and in-solution capture to reconstruct Y. pestis genomes from Bronze Age individuals (RT5 and RT6) in the Samara region. In addition, we retrieved a 4.2-fold human genome from individual RT5 through shotgun sequencing. Population genetic analysis identified individual RT5 as having close genetic affinity to EBA European populations and MLBA populations from the Eurasian steppe region.
the black plague was spread by mongols and mostly EEF italian merchants fleeing crimea, wth are you talking about
TheOldNorth
11-04-2019, 03:04 AM
I am just stating a fact. I don't buy the we left and came back story
who said they didn't pick up some genetic baggage on the way? the genetics say a bunch of jewish men and far fewer jewish women came to italy during the roman empire days, picked up some roman brides, and when rome fell, mostly fled to the rhine and then eastern europe, and they picked up 40% of their DNA in italy, and less then 5% on average from the rhine and beyond until recent times
TheOldNorth
11-04-2019, 03:06 AM
I want to hear your theory where Jews come from then.
she probably thinks they're Khazars like some Zionist plot conspiracy theorist
TheOldNorth
11-04-2019, 03:08 AM
Yes.
you know I love how you go on about aryan supremacy and then talk about how city dwelling farmers are superior to the aryans
dududud
11-04-2019, 05:22 AM
My mother :
rs9264942(C;C)
90% reduction in HIV viral load The rs9264942(C;C) genotype is reported to be associated with a 90% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV.
This SNP (C/T) is in 5' region of the HLA-C gene, 35 kb away from transcription initiation in or around the HLA-C gene. "People with this tiny sequence variation, dubbed rs9264942, appear to have up to 90% less virus in their systems than those who carry other polymorphisms. About 10% of Europeans appear to carry two copies of rs9264942, which leads to an average 90% viral load reduction. About 50% of Europeans carry one copy, which gives a 60% reduction. By comparison, less than 40% of people of African descent appear to carry a single copy of the polymorphism." Genetic variation may lower HIV load by 90% They are referring to the (C;C) genotype giving a 90% reduction and the (C;T) giving a 60% reduction. dbSNP page This SNP is also reported to account for 6.5% of the 15% variation in viral load set point in asymptomatic...
more info
I'm, like my cousin (same sardinian grandfather, except mine is on maternal side), C/T (rs9264942(C;T)
60% reduction in HIV viral load The rs9264942(C;T) genotype is reported to be associated with a 60% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV)
Peterski
11-04-2019, 09:02 AM
The map shows cleary that Jews are not native to Israel unless vikings were doing aliyah at the time, which I doubt.
Why do you doubt?: https://en.wikipedia.org/wiki/Normans#On_crusade
https://www.youtube.com/watch?v=X7a9-OOV_Qw
https://www.youtube.com/watch?v=GwMImWeS_Uc
https://www.youtube.com/watch?v=41Dot2JWjmw
https://www.youtube.com/watch?v=lcjMnfPWxIg
the black plague was spread by mongols and mostly EEF italian merchants fleeing crimea, wth are you talking about
Lol. He is talking about bronze age, not about medieval black death. It indeed did spread with Indo-Europeans from steppes.
dududud
11-04-2019, 09:11 AM
Lol. He is talking about bronze age, not about medieval black death. It indeed did spread with Indo-Europeans from steppes.
Do you think the C;C of my mother come from her mother, so?
Enr1989
11-04-2019, 09:19 AM
My mother :
rs9264942(C;C)
90% reduction in HIV viral load The rs9264942(C;C) genotype is reported to be associated with a 90% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV.
This SNP (C/T) is in 5' region of the HLA-C gene, 35 kb away from transcription initiation in or around the HLA-C gene. "People with this tiny sequence variation, dubbed rs9264942, appear to have up to 90% less virus in their systems than those who carry other polymorphisms. About 10% of Europeans appear to carry two copies of rs9264942, which leads to an average 90% viral load reduction. About 50% of Europeans carry one copy, which gives a 60% reduction. By comparison, less than 40% of people of African descent appear to carry a single copy of the polymorphism." Genetic variation may lower HIV load by 90% They are referring to the (C;C) genotype giving a 90% reduction and the (C;T) giving a 60% reduction. dbSNP page This SNP is also reported to account for 6.5% of the 15% variation in viral load set point in asymptomatic...
more info
I'm, like my cousin (same sardinian grandfather, except mine is on maternal side), C/T (rs9264942(C;T)
60% reduction in HIV viral load The rs9264942(C;T) genotype is reported to be associated with a 60% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV)
I have the same combination
dududud
11-04-2019, 09:21 AM
I have the same combination
Interesting...
Do you think the C;C of my mother come from her mother, so?
Sorry, I really have no clue about these things. :(
dududud
11-04-2019, 09:51 AM
Sorry, I really have no clue about these things. :(
Don't worry. Pas de problème, Madame !
Enr1989
11-04-2019, 09:53 AM
Do you think the C;C of my mother come from her mother, so?
you get one from each parent, also your mother did
dududud
11-04-2019, 09:57 AM
you get one from each parent, also your mother did
So her father is maybe C;T and her mother C;C or vice versa ?
Adamm
11-04-2019, 10:06 AM
My mother :
rs9264942(C;C)
90% reduction in HIV viral load The rs9264942(C;C) genotype is reported to be associated with a 90% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV.
This SNP (C/T) is in 5' region of the HLA-C gene, 35 kb away from transcription initiation in or around the HLA-C gene. "People with this tiny sequence variation, dubbed rs9264942, appear to have up to 90% less virus in their systems than those who carry other polymorphisms. About 10% of Europeans appear to carry two copies of rs9264942, which leads to an average 90% viral load reduction. About 50% of Europeans carry one copy, which gives a 60% reduction. By comparison, less than 40% of people of African descent appear to carry a single copy of the polymorphism." Genetic variation may lower HIV load by 90% They are referring to the (C;C) genotype giving a 90% reduction and the (C;T) giving a 60% reduction. dbSNP page This SNP is also reported to account for 6.5% of the 15% variation in viral load set point in asymptomatic...
more info
I'm, like my cousin (same sardinian grandfather, except mine is on maternal side), C/T (rs9264942(C;T)
60% reduction in HIV viral load The rs9264942(C;T) genotype is reported to be associated with a 60% reduction in viral load in HIV-infected individuals. [] See also rs9264942 and HIV)
I got the same as you, it's probably normal for all people to have that.
Enr1989
11-04-2019, 10:42 AM
So her father is maybe C;T and her mother C;C or vice versa ?
Yes, they had at least a c each
TheOldNorth
11-04-2019, 02:53 PM
Lol. He is talking about bronze age, not about medieval black death. It indeed did spread with Indo-Europeans from steppes.
oh, to be honest I forgot there was a bronze age black death
Imperator Biff
11-04-2019, 09:06 PM
David Reich published a study on the CCR5 allele related to HIV progression back in the 90s I think.
Swedes are the most homozygous.
Annihilus
11-05-2019, 11:35 AM
who said they didn't pick up some genetic baggage on the way? the genetics say a bunch of jewish men and far fewer jewish women came to italy during the roman empire days, picked up some roman brides, and when rome fell, mostly fled to the rhine and then eastern europe, and they picked up 40% of their DNA in italy, and less then 5% on average from the rhine and beyond until recent times
Yes, mixed to a point they became European. Look Judaism is just a religion and they had a time they expanded mostly by conversions. How else can you have fully black or Chinese Jews?
Yes, mixed to a point they became European. Look Judaism is just a religion and they had a time they expanded mostly by conversions. How else can you have fully black or Chinese Jews?
What % European do you think they are and what kinda European?
L3mon J3lly
11-07-2019, 10:31 PM
Yes, mixed to a point they became European. Look Judaism is just a religion and they had a time they expanded mostly by conversions. How else can you have fully black or Chinese Jews?
Nonsense. Jews were already mixed with Europeans such as Scythians, from whom they got a lot of R1a and Q1b haplogroups from when they invaded the middle east. Studies just don't call it "European" because it will hurt their bitchboy feelings if they have to admit anyone anywhere got European DNA from their paternal side. AngloJew has done a lot of writing on this subject.
Harkonnen
11-07-2019, 10:35 PM
And how the hell are Indo-Europeans once again pulled into this? As far as I know this mutation was thought to rise in middle ages during plague.
Harkonnen
11-07-2019, 10:41 PM
CCR5 has literally nothing to do with Indo-Aryans and everything to do with the black plague, small pox and other diseases. It also is said to originate in Northern Europe not in the Indo-Aryan strongholds.
This is exactly what I thought, and even the spread seems point to something like that. I don't know if they have found something new.
Harkonnen
11-07-2019, 10:49 PM
Not HIV resistant = not Aryan.
I literally have double skull breadth to the Aryans. So I'm deffo not Aryan.
Harkonnen
11-07-2019, 11:08 PM
There is a saying that Jews put their nose in every matter. But I think the real Jews are the Indo-Europeans. HAVE SOME RESPECT YOU FUCKING NIGGERS
Harkonnen
11-07-2019, 11:13 PM
Well in any case those higher than average percentages are clearly the result of recent bottlenecks, so they are not indicative of real Indo-European ancestry.
Harkonnen
11-07-2019, 11:21 PM
I have no agenda, i'm just perplexed at how dumb and physically inept were North European hunters. Farmers at least had cities.
Wuuuut what is this Jewtalk? Oh I forgot, I'm talking to a Indo-European.
PaleoEuropean
11-08-2019, 12:01 AM
This is exactly what I thought, and even the spread seems point to something like that. I don't know if they have found something new.
I think the highest concentration of the mutation is in Finland/Sweden could have developed when the Asiatic peoples mixed with Hunter Gatherers and Neolithic Farmers, could have even been carried by the Neolithic Farmers, there are an immense number of possibilities.
I think the highest concentration of the mutation is in Finland/Sweden could have developed when the Asiatic peoples mixed with Hunter Gatherers and Neolithic Farmers, could have even been carried by the Neolithic Farmers, there are an immense number of possibilities.
The Saami
Lemon Kush
11-08-2019, 12:12 AM
16.5% is the highest? I still wouldn't take that gamble
Voskos
11-08-2019, 12:18 AM
Israel= aryan.
Sp_loa
11-11-2019, 02:48 PM
My grandmother is a carries (Heterozygous) and has other snps against HIV. I have no idea about my self (when I take 23andme I’ll know).
When it comes to medical genetics I have the win-win situation. I have snps that are associated with autoimmunity in the European population (increased risk for Celiac and other disorders and Indeed I have celiac and so many autoimmune disorders that my immunologist said I just have a condition called Immune-Dysregulation).
But I am also lactose intolerant (and the only one in my family), probably from the non European roots.
Fun (:
Kamal900
11-15-2019, 06:45 PM
Um..brah. Only Indo-Iranians are the real Aryans, not Europeans. My Persian friend, Babak, is a fine example of an Aryan.
https://pbs.twimg.com/profile_images/915543535163645952/ZEC4WGoH_400x400.jpg
Token
11-15-2019, 06:50 PM
Um..brah. Only Indo-Iranians are the real Aryans, not Europeans. My Persian friend, Babak, is a fine example of an Aryan.
I remember Babak denying with all his might the European roots of Proto-Indo-Iranic people. Now he at least accept the undeniable truth, that Indo-Iranians were originally North Europeans living in the Central Asian steppes.
Babak
11-15-2019, 07:31 PM
I remember Babak denying with all his might the European roots of Proto-Indo-Iranic people. Now he at least accept the undeniable truth, that Indo-Iranians were originally North Europeans living in the Central Asian steppes.
North european-like* There's a difference bud.
Babak
11-15-2019, 07:53 PM
Um..brah. Only Indo-Iranians are the real Aryans, not Europeans. My Persian friend, Babak, is a fine example of an Aryan.
https://pbs.twimg.com/profile_images/915543535163645952/ZEC4WGoH_400x400.jpg
Lol yep. Europeans have nothing to do with Aryans.
Powered by vBulletin® Version 4.2.3 Copyright © 2026 vBulletin Solutions, Inc. All rights reserved.